Medical and Societal information from the Research Community	Number of Articles: 17,750,454 Number of Contributors: 57 Number of Queries: 12,901,611
	Save this page:  Send this page	Login  or Create a Free Account

GST Primary GST Primary Best Strategies for Health Care Quality Im... Best Strategies for Health Care Quality Improvement - Diabetes Quality Improvement Strategies for Antibio... Kathryn McDonald, Stanford-UCSF Evidence-b... Systematic review assessing the effect of ... Quality Improvement Strategies for Antibiotics Management Kathryn McDonald, Stanford-UCSF Evidence-based Practice Center, 117 Encina Commons, Stanford, CA 94305-6019, Kathy.mcdonald@stanford.edu Systematic review assessing the effect of quality improvement strategies on appropriate prescribing of antibiotics and appropriate choice of antibiotics. Adherence Adherence Assistive Devices Assistive Devices Childhood Burn Hanson MacMillan Childhood Burn Hanson MacMillan CLSA_9 CLSA_9 Cyberabuse Cyberabuse Cognitive Behavioural Therapy for Violent ... This review included randomized trials abo... Cognitive Behavioural Therapy for Violent Men who Batter Their Partners This review included randomized trials about the effects of cognitive behavioral therapy on domestic violence. The intervention included programs based on the Duluth Model. The violence had to be committed by a male toward his female partner. The violence also had to be physical. The primary outcomes were new arrests and convictions, and new reports of violence. CABG vs PCI CABG vs PCI Quality Improvement Strategies for Prevent... Quality Improvement Strategies for Preventing Nosocomial Infections (Created 17-Feb-06) Quality Improvement Strategies for Asthma ... Quality Improvement Strategies for Asthma Control Erectile Dysfunction (Created 30-Jan-06) Erectile Dysfunction (Created 30-Jan-06) Inequality - Smoking Cessation to Reduce S... This review was the first part of a projec... Inequality - Smoking Cessation to Reduce Socio-Economic Differences This review was the first part of a project about inequality. It included randomized trials about the effect of smoking cessation interventions on reducing socio-economic differences. The studies had to report data either on persons with low socio-economic groups status or, preferably, on both low and high socio-economic groups. Diet and Physical Activity to Reduce Socio... This review was the second part in a proje... Diet and Physical Activity to Reduce Socio-Economic Differences This review was the second part in a project about inequality. It included randomized trials about the effect of interventions on reducing socio-economic differences in diet and physical activity. The studies had to report data either on persons with low socio-economic groups status or, preferably, on both low and high socio-economic groups. Workfare The data in SRS are not identical to the d... Workfare The data in SRS are not identical to the data in the published report. We used SRS only for an updated search. The review included randomized trials about the effect of welfare-to-work programs. Participants were welfare recipients. There were basically two types of programs. The educational type tried to build knowledge and skills in order to help the welfare recipients acquire jobs that could support them economically. The "work first" approach was more aimed at getting the participants quickly into a job. Exercise interventions for the management ... The objective of this systematic review wa... Exercise interventions for the management of frailty The objective of this systematic review was to examine the effectiveness of current exercise interventions on the management of frailty. A comprehensive search of Medline, Embase, Psycinfo, Cinahl, Scopus, Ageline, Eric, and SportDiscus databases was conducted and produced 1808 citations. So far we have completed 2 levels of “title and abstract” screening and we ended up with 262 articles. We have just started the full text screening. Eligibility criteria included original studies whose participants were identified as frail or prefrail with specific criteria and in which structured physical activity was included as at least one component of the intervention. Create a free account, build a dictionary with saved terms to re-use later! Public Domestic Violence - Using Cognitive Behavior Therapy Smoking Cessation to Reduce Socio-Economic Differences Diet and Physical Activity to Reduce Socio-Economic Differences Workfare Exercise Interventions for the Management of Frailty Search     Simple Advanced Refine (3 coded questions)  Any of these:   Exact Phrase: All of these: None of these: Author: Periodical: Projects: No restrictions   Libraries: Public   Select SRS Projects Show Saved Terms Select Library Show articles that do not have abstracts  Type of Article Clinical Trial Editorial Letter Meta-Analysis Practice Guideline Randomized Controlled Trial Review Addresses Bibliography Biography Case Reports Classical Article Clinical Conference Clinical Trial, Phase I Clinical Trial, Phase II Clinical Trial, Phase III Clinical Trial, Phase IV Comment Comparative Study Consensus Development Conference Consensus Development Conference, NIH Controlled Clinical Trial Corrected and Republished Article Dictionary Directory Duplicate Publication English Abstract Evaluation Studies Festschrift Government Publications Guideline Historical Article Interview In Vitro Journal Article Lectures Legal Cases Legislation Multicenter Study News Newspaper Article Overall Patient Education Handout Periodical Index Published Erratum Retracted Publication Research Support, N.I.H., Extramural Research Support, N.I.H., Intramural Research Support, Non-U.S. Gov't Research Support, U.S. Gov't, Non-P.H.S. Research Support, U.S. Gov't, P.H.S. Retraction of Publication Scientific Integrity Review Support of Research Technical Report Twin Study Validation Studies Not a Primary Study or Review Unknown Primary Study Case Series Case Control Cohort Study Observational Study Qualitative Research CBA or ITS Registry Double Blind Controlled before after study Quasi-randomized trial Simple before after study Cluster-RCT Non-Randomized Study Report Book Book chapter Dissertation Conference procedings Secondary Research Not RCT Humans or Animals Humans Animals Ages All Infant: birth-23 months All Child: 0-18 years All Adult: 19+ years Newborn: birth-1 month Infant: 1-23 months Preschool Child: 2-5 years Child: 6-12 years Adolescent: 13-18 years Adult: 19-44 years Middle Aged: 45-64 years Middle Aged + Aged: 45+ years Aged: 65+ years 80 and over: 80+ years Undetermined Results(1-25 of 32) Sort By: Publication Date Relevance Took: 0.026 seconds to search 17,750,454  Action: Copy Results to new Clipboard Build Search Link Page 1 of 2 1 2 > (32 articles found) Epigenetic modifications of SOX2 enhancers, SRR1 and SRR2, correlate with in vitro neural differentiation. Jun 2008 Marianna Sikorska,Jagdeep K Sandhu,Paromita Deb-Rinker,Anna Jezierski,Julie Leblanc,Claudie Charlebois,Maria Ribecco-Lutkiewicz,Mahmud Bani-Yaghoub,P Roy Walker SOX2 is a key neurodevelopmental gene involved in maintaining the pluripotency of stem cells and proliferation of neural progenitors and astroglia. Two evolutionally conserved enhancers, SRR1 and SRR2, are involved in controlling SOX2 expression during neurodevelopment; however, the molecular mecha... ( view more )nisms regulating their activity are not known. We have examined DNA methylation and histone H3 acetylation at both enhancers in NT2-D1 progenitors, neurons and astrocytes, to establish the role of epigenetic mechanisms in cell-type-specific SOX2 expression. This study showed that 1) unmethylated DNA and acetylated histones at both enhancers correlated with a high level of SOX2 expression in proliferating neural progenitors and 2) reversible modifications of the SRR1 element were observed during gene reexpression in astrocytes, whereas permanent epigenetic marks on the SRR2 enhancer were seen in neurons where the gene was silenced. Taken together, these results are clear illustrations of cell-type-specific epigenomes and suggest mechanisms by which they may be created and maintained. ( view less ) View Full Abstract View Article Details View Coded Data Related Articles Duplexiphane: a polyaromatic receptor containing two adjoined Delta-shaped cavities for an efficient hopping of a single silver cation. Feb 7, 2008 Susanna J Emond,Paromita Debroy,Rajendra Rathore A simple synthesis of a polyaromatic receptor (i.e., duplexiphane) containing two adjoined Delta-shaped cavities is accomplished via an intramolecular (double) McMurry coupling, and its structure is established by X-ray crystallography. The binding of silver cation to duplexiphane showed that it bi... ( view more )nds only a single silver cation with significantly higher efficiency (>100 times) than a model compound containing only one pi-prismand-like cavity, and the single silver cation hops intramolecularly between the two adjoined cavities in duplexiphane. ( view less ) View Full Abstract View Article Details View Coded Data Related Articles Hexabenzo[4.4.4]propellane: a helical molecular platform for the construction of electroactive materials. Oct 11, 2007 Paromita Debroy,Sergey V Lindeman,Rajendra Rathore Helical hexabenzo[4.4.4]propellane (a relative of hexaphenylethane) and its derivatives are synthesized and their structures are established by X-ray crystallography. Isolation and X-ray crystallographic characterization of a robust trication-radical salt of hexamethoxypropellane derivative confirm... ( view more )s that its framework is stable toward oxidative (aliphatic) C-C bond cleavage. It is also demonstrated that propellane can be easily brominated at the 4,4'-positions of the biphenyl linkages for its usage as a molecular platform for the preparation of electroactive materials. ( view less ) View Full Abstract View Article Details View Coded Data Related Articles New insights into purinergic receptor signaling in neuronal differentiation, neuroprotection, and brain disorders. Sep 2007 Paromita Majumder,Cleber A Trujillo,Camila G Lopes,Rodrigo R Resende,Katia N Gomes,Katia K Yuahasi,Luiz R G Britto,Henning Ulrich Ionotropic P2X and metabotropic P2Y purinergic receptors are expressed in the central nervous system and participate in the synaptic process particularly associated with acetylcholine, GABA, and glutamate neurotransmission. As a result of activation, the P2 receptors promote the elevation of free i... ( view more )ntracellular calcium concentration as the main signaling pathway. Purinergic signaling is present in early stages of embryogenesis and is involved in processes of cell proliferation, migration, and differentiation. The use of new techniques such as knockout animals, in vitro models of neuronal differentiation, antisense oligonucleotides to induce downregulation of purinergic receptor gene expression, and the development of selective inhibitors for purinergic receptor subtypes contribute to the comprehension of the role of purinergic signaling during neurogenesis. In this review, we shall discuss the participation of purinergic receptors in developmental processes and in brain physiology, including neuron-glia interactions and pathophysiology. ( view less ) View Full Abstract View Article Details View Coded Data Related Articles Bilateral lens subluxation in a case of lipoid proteinosis. Aug 2007 Subrata Mandal,Paromita Dutta,Pradeep Venkatesh,Rajesh Sinha,Manu Kukreja,Satpal Garg We report a patient who presented with pain, redness, and diminution of vision in the right eye and low vision in the left eye. Ophthalmologic examination showed characteristic eyelid lesions, anterior dislocation of the crystalline lens in the right eye, and nasal subluxation in the left eye. The ... ( view more )patient's voice was hoarse, and he had skin lesions. After histopathologic examination of the skin biopsy, lipoid proteinosis (LP) was diagnosed. Bilateral pars plana lensectomy was performed. The ophthalmic manifestations of LP are discussed. ( view less ) View Full Abstract View Article Details   Related Articles Immobilized P2X2 purinergic receptor stationary phase for chromatographic determination of pharmacological properties and drug screening. Jul 27, 2007 Cleber A Trujillo,Paromita Majumder,Fernando A Gonzalez,Ruin Moaddel,Henning Ulrich The purinergic receptor signaling system plays an important role in communication between cells in the nervous system and opens new opportunities for screening of potential drugs. Our objective was to explore the pharmacological properties and establish a new methodology for ligand screening for th... ( view more )e P2X2 receptor, which has been developed by the combinatorial library approach Systematic Evolution of Ligands by Exponential enrichment (SELEX). To this end, membranes of 1321N1 cells stably transfected with rat P2X2 receptors were resuspended in 2% cholate detergent and subsequently coupled onto an immobilized artificial membrane (IAM). The IAM-cholate-P2X2 mixture was then dialyzed, centrifuged and packed into a FPLC column. Equilibrium binding to the receptor and competition between ATP and the purinergic antagonists suramin and 2'3'-O-(2,4,6-trinitrophenyl) adenosine 5'-triphosphate (TNP-ATP) were analyzed by a chromatographic assay using 32P alpha ATP as a radioligand. Our data indicate that suramin does not compete with ATP for the ligand binding site and TNP-ATP is a competitive antagonist, confirming previous studies [C.A. Trujillo, A.A. Nery, A.H. Martins, P. Majumder, F.A. Gonzalez, H. Ulrich, Biochemistry 45 (2006) 224-233]. In addition, we demonstrate that this assay can be used in in vitro selection procedures for RNA aptamers binding to P2X2 receptors. The results demonstrate that the receptor can be immobilized in a stable format and reused over an extended period of time, facilitating the exploration of ligand-receptor interactions and screening of combinatorial pools for possible ligands. ( view less ) View Full Abstract View Article Details View Coded Data Related Articles Characterization of SERCA2b Ca2+-Mg2+ ATPase mRNA decay by nuclear proteins. Jun 2007 Tao Chen,Paromita Ghosh,Christine M Misquitta,Archana Govindan,Ashok K Grover Gene expression is controlled at several levels including mRNA decay. Sarco/endoplasmic reticulum Ca2+-Mg2+-ATPase isoform 2b (SERCA2b) is central to Ca2+ signalling and homeostasis in several tissues. SERCA2b mRNA decay involves interactions between cis-acting elements in its 3'-region and trans-a... ( view more )cting nuclear protein factors. In the presence of the protein factors, the synthetic capped and polyadenylated RNA fragment 2b1 (3444-3753) decays faster than other SERCA2b 3'-region fragments. Here we determined the minimum cis-acting destabilizing element in the decay and its interactions with the nuclear protein factors. The in vitro decay required ATP hydrolysis and Mg2+ but not Ca2+. The decay was directional from 3' to 5', and involved a novel 35b GC rich domain designated 2b1-4 corresponding to 3521-3555. The decay of 2b1 RNA was decreased by (a) competition with 2b1-4, (b) mutation of 2b1 to delete 2b1-4, and (c) depleting the extracts of destabilizing trans-acting factors using immobilized 2b1-4. To determine the minimal destabilizing elements 2b1-4 was divided into 7b domains A-E. Deleting AB, BC, CD or DE inactivated the destabilizing cis-acting element but deleting A, B, C, D or E had no effect. In electrophoresis mobility shift assays the nuclear protein extracts retarded the mobility of labeled uncapped 2b1 RNA without a poly A+ tail. A positive co-operativity in the interactions was shown in protein concentration dependence of the shift and in the competition of 2b1-4 in inhibiting the mobility of 2b1 RNA. Based on further experiments, the domain CDE (3535-3555) was sufficient to compete with 2b1 RNA for the protein binding. Consistent with this competition, excess CDE RNA retarded the in vitro decay of 2b1 RNA. Thus the RNA decay required ATP hydrolysis and Mg2+ but not Ca2+, the minimum binding domain was in the sequence 3535-3555, and the decay may involve a multimeric protein complex. ( view less ) View Full Abstract View Article Details   Related Articles Automated vitrector-assisted optical iridectomy: customized iridectomy. Jun 2007 Tushar Agarwal,Vishal Jhanji,Paromita Dutta,Radhika Tandon,Namrata Sharma,Jeewan S Titiyal,Rasik B Vajpayee An automated vitrector was used to create an optical iridectomy in 15 eyes of 15 patients with leucomatous corneal opacities. The optical iridectomy was performed successfully through a standard 1.2 mm incision in all eyes. No intraoperative complications were observed, and there was no case of iat... ( view more )rogenic cataract formation. The median best corrected visual acuity improved from 1/60 (range light perception to 6/60) preoperatively to 6/24 (range 6/60 to 6/12) at the last follow-up (mean 28 days). An automated vitrector can be successfully used to create an optical iridectomy in eyes with leucomatous corneal opacities. This technique was safe and could be performed through a small surgical incision. ( view less ) View Full Abstract View Article Details   Related Articles Preparation of chiral cholestanofluorene and its electron-rich derivatives for isolation of a stable cation-radical salt. Mar 2, 2007 Paromita Debroy,Ruchi Shukla,Sergey V Lindeman,Rajendra Rathore A simple and practical synthesis of a variety of chiral fluorene derivatives is described where a cholestane moiety is attached to the carbon 9 of the fluorene ring system from readily available starting materials. An appropriately substituted fluorene derivative (i.e., R = OMe) forms a highly colo... ( view more )red (chiral) cation-radical that can be isolated as robust hexachloroantimonate salt. Interestingly, the simplest cholestanofluorene (i.e., R = H) can also be transformed into a dibromo derivative (i.e., R = Br), a precursor to the (poly)cholestanofluorenes where the cholestane moieties will serve not only as groups that impart chirality but also allow them to be soluble in common organic solvents. The details of these works are described. ( view less ) View Full Abstract View Article Details   Related Articles Substitution of critical isoleucines in the KH domains of Drosophila fragile X protein results in partial loss-of-function phenotypes. Mar 2007 Paromita Banerjee,Shweta Nayar,Sarita Hebbar,Catherine F Fox,Michele C Jacobs,Jae H Park,Joyce J Fernandes,Thomas C Dockendorff Fragile X mental retardation proteins (FMRP) are RNA-binding proteins that interact with a subset of cellular RNAs. Several RNA-binding domains have been identified in FMRP, but the contribution of these individual domains to FMRP function in an animal model is not well understood. In this study, w... ( view more )e have generated flies with point mutations in the KH domains of the Drosophila melanogaster fragile X gene (dfmr1) in the context of a genomic rescue fragment. The substitutions of conserved isoleucine residues within the KH domains with asparagine are thought to impair binding of RNA substrates and perhaps the ability of FMRP to assemble into mRNP complexes. The mutants were analyzed for defects in development and behavior that are associated with deletion null alleles of dfmr1. We find that these KH domain mutations result in partial loss of function or no significant loss of function for the phenotypes assayed. The phenotypes resulting from these KH domain mutants imply that the capacities of the mutant proteins to bind RNA and form functional mRNP complexes are not wholly disrupted and are consistent with biochemical models suggesting that RNA-binding domains of FMRP can function independently. ( view less ) View Full Abstract View Article Details View Coded Data Related Articles HnRNP E2 is downregulated in human oral cancer cells and the overexpression of hnRNP E2 induces apoptosis. Mar 2007 Paromita Roychoudhury,Ranjan Rashmi Paul,Rajdeep Chowdhury,Keya Chaudhuri Human hnRNP genes have been reported to be involved in human malignancies and several hnRNPs are promising biomarkers of lung, head and neck, colon, breast, and pancreatic cancers. The present study investigated the clinicopathologic and biological significance of hnRNP E2 gene expression in oral c... ( view more )ancer. Human hnRNP E2 was significantly downregulated in oral cancer tissues compared to normal one (P<0.0001) as determined by quantitative real-time reverse transcription PCR. The expression of hnRNP E2 is correlated with histology, being lower in moderate and poorly differentiated squamous cell carcinoma (SCC) compared to well-differentiated SCC. Transient transfection of hnRNP E2 in cancerous cell lines resulted in reduced cell viability and increased apoptotic nuclei. Compared to control transfectants, cells with higher expression showed an increase in the number of apoptotic cells by annexin-PI staining and an increase in caspase activity. The present study thus implicates downregulation of hnRNP E2 as a novel mechanism to enhance the resistance of cancer cells to apoptosis. ( view less ) View Full Abstract View Article Details   Related Articles Activation of mitochondrial promoter P(H)-binding protein in a radio-resistant Chinese hamster cell strain associated with Bcl-2. Nov 17, 2006 Paromita Roychoudhury,Utpal Ghosh,Nitai P Bhattacharyya,Keya Chaudhuri The cellular response to ionizing radiation is mediated by a complex interaction of number of proteins involving different pathways. Previously, we have shown that up regulation of mitochondrial genes ND1, ND4, and COX1 transcribed from the heavy strand promoter (P(H)) has been increased in a radio... ( view more )-resistant cell strain designated as M5 in comparison with the parental Chinese hamster V79 cells. These genes are also up regulated in Chinese hamster V79 cells VB13 that express exogenous human Bcl2. In the present study, the expression of the gene ND6 that is expressed from the light strand promoter (P(L)) was found to be similar in both the cell lines, as determined by RT-PCR. To test the possibility that this differential expression of mitochondrial genes under these two promoters was mediated by differences in proteins' affinity to interact with these promoters, we have carried out electrophoretic mobility shift assay (EMSA) using mitochondrial cell extracts from these two cell lines. Our result of these experiments revealed that two different proteins formed complex with the synthetic promoters and higher amount of protein from M5 cell extracts interacted with the P(H) promoter in comparison to that observed with cell extracts from Chinese hamster V79 cells. The promoter-specific differential binding of proteins was also observed in VB13. These results showed that differential mitochondrial gene expression observed earlier in the radio-resistant M5 cells was due to enhanced interaction proteins with the promoters P(H) and mediated by the expression of Bcl2. ( view less ) View Full Abstract View Article Details   Related Articles DNA and RNA aptamers: from tools for basic research towards therapeutic applications. Sep 2006 Henning Ulrich,Cleber A Trujillo,Arthur A Nery,Janaina M Alves,Paromita Majumder,Rodrigo R Resende,Antonio H Martins The systematic evolution of ligands by exponential enrichment (SELEX) is a combinatorial oligonucleotide library-based in vitro selection approach in which DNA or RNA molecules are selected by their ability to bind their targets with high affinity and specificity, comparable to those of antibodies.... ( view more ) Nucleic acids with high affinity for their targets have been selected against a wide variety of compounds, from small molecules, such as ATP, to membrane proteins and even whole organisms. Recently, the use of the SELEX technique was extended to isolate oligonucleotide ligands, also known as aptamers, for a wide range of proteins of importance for therapy and diagnostics, such as growth factors and cell surface antigens. The number of aptamers generated as inhibitors of various target proteins has increased following automatization of the SELEX process. Their diagnostic and therapeutic efficacy can be enhanced by introducing chemical modifications into the oligonucleotides to provide resistance against enzymatic degradation in body fluids. Several aptamers are currently being tested in preclinical and clinical trials, and aptamers are in the process of becoming a new class of therapeutic agents. Recently, the anti-VEGF aptamer pegaptanib received FDA approval for treatment of human ocular vascular disease. ( view less ) View Full Abstract View Article Details   Related Articles Children's residential exposure to chlorpyrifos: application of CPPAES field measurements of chlorpyrifos and TCPy within MENTOR/SHEDS-Pesticides model. Aug 1, 2006 Paromita Hore,Valerie Zartarian,Jianping Xue,Halûk Ozkaynak,Sheng-Wei Wang,Yu-Ching Yang,Pei-Ling Chu,Linda Sheldon,Mark Robson,Larry Needham,Dana Barr,Natalie Freeman,Panos Georgopoulos,Paul J Lioy The comprehensive individual field-measurements on non-dietary exposure collected in the Children's-Post-Pesticide-Application-Exposure-Study (CPPAES) were used within MENTOR/SHEDS-Pesticides, a physically based stochastic human exposure and dose model. In this application, however, the model was r... ( view more )un deterministically. The MENTOR/SHEDS-Pesticides employed the CPPAES as input variables to simulate the exposure and the dose profiles for seven children over a 2-week post-application period following a routine residential and professional indoor crack-and-crevice chlorpyrifos application. The input variables were obtained from a personal activity diary, microenvironmental measurements and personal biomonitoring data obtained from CPPAES samples collected from the individual children and in their homes. Simulation results were compared with CPPAES field measured values obtained from the children's homes to assess the utility of the different microenvironmental data collected in CPPAES, i.e. indicator toys and wipe samplers to estimate aggregate exposures that can be result from one or more exposure pathways and routes. The final analyses of the database involved comparisons of the actual data obtained from the individual biomarker samples of a urinary metabolite of chlorpyrifos (TCPy) and the values predicted by MENTOR/SHEDS-Pesticides using the CPPAES-derived variables. Because duplicate diet samples were not part of the CPPAES study design, SHEDs-Pesticides simulated dose profiles did not account for the dietary route. The research provided more confidence in the types of data that can be used in the inhalation and dermal contact modules of MENTOR/SHEDS-Pesticides to predict the pesticide dose received by a child. It was determined that we still need additional understanding about: (1) the types of activities and durations of activities that result in non-dietary ingestion of pesticides and (2) the influence of dietary exposures on the levels of TCPy found in the urine. ( view less ) View Full Abstract View Article Details View Coded Data Related Articles Inhibition mechanism of the recombinant rat P2X(2) receptor in glial cells by suramin and TNP-ATP. Jan 10, 2006 Cleber A Trujillo,Arthur A Nery,Antonio Henrique B Martins,Paromita Majumder,Fernando A Gonzalez,Henning Ulrich P2X receptors play an important role in communication between cells in the nervous system. Therefore, understanding the mechanisms of inhibition of these receptors is important for the development of new tools for drug discovery. Our objective has been to determine the pharmacological activity of t... ( view more )he antagonist suramin, the most important antagonist of purinergic receptor function, as well as to demonstrate its noncompetitive inhibition and confirm a competitive mechanism between ATP and TNP-ATP in 1321N1 glial cells stably transfected with the recombinant rat P2X(2) receptor. A radioligand binding assay was employed to determine whether suramin, TNP-ATP, and ATP compete for the same binding site on the receptor. TNP-ATP displaced [alpha-32P]ATP, whereas suramin did not interfere with [alpha-32P]ATP-receptor binding. To determine the inhibition mechanism relevant for channel opening, currents obtained in fast kinetic whole-cell recording experiments, following stimulation of cells by ATP in the presence of suramin, were compared to those obtained by ATP in the presence of TNP-ATP. Supported by a mathematical model for receptor kinetics [Breitinger, H. G., Geetha, N., and Hess, G. P. (2001) Biochemistry 40, 8419-8429], the inhibition factors were plotted as functions of inhibitor or agonist concentrations. Analysis of the data indicated a competitive inhibition mechanism for TNP-ATP and a noncompetitive inhibition for suramin. Taken together, both data support a noncompetitive inhibition mechanism of the rat recombinant P2X(2) receptor by suramin, confirm the competitive inhibition by TNP-ATP, and allow the prediction of a model for P2X(2) receptor inhibition. ( view less ) View Full Abstract View Article Details View Coded Data Related Articles Molecular determinants of picrotoxin inhibition of 5-hydroxytryptamine type 3 receptors. Jul 2005 Paromita Das,Glenn H Dillon Previously, we reported that the GABA(A) receptor antagonist picrotoxin also antagonizes serotonin (5-HT)3 receptors and that its effects are subunit-dependent. Here, we sought to identify amino acids involved in picrotoxin inhibition of 5-HT3 receptors. Mutation of serine to alanine at the transme... ( view more )mbrane domain 2 (TM2) 2' position did not affect picrotoxin (PTX) sensitivity in murine 5-HT3A receptors. However, mutation of the 6' TM2 threonine to phenylalanine dramatically reduced PTX sensitivity. Mutation of 6' asparagine to threonine in the 5-HT3B subunit enhanced PTX sensitivity in heteromeric 5-HT3A/3B receptors. Introduction of serine (native to the human 3B subunit) at the 6' position also increased PTX sensitivity, suggesting a species-specific effect. Mutation of the 7' leucine to threonine in 5-HT3A receptors increased PTX sensitivity roughly 10-fold, comparable with that observed in GABA(A) receptors, and also conferred distinct gating kinetics. The equivalent mutation in the 3B subunit (i.e., 7' valine to threonine) had no impact on PTX sensitivity in 5-HT3A/3B receptors. Interestingly, [3H]ethynylbicycloorthobenzoate ([3H]EBOB), a high-affinity ligand to the convulsant site in GABA(A) receptors, did not exhibit specific binding in 5-HT3A receptors. The structurally related compound, tert-butylbicyclophosphorothionate (TBPS), which potently inhibits GABA(A) receptors, did not inhibit 5-HT3 currents. Our results indicate that the TM2 6' residue is a common determinant of PTX inhibition of both 5-HT3 and GABA(A) receptors and demonstrate a role of the 7' residue in PTX inhibition. However, lack of effects of EBOB and TBPS in 5-HT3A receptors suggests that the functional domains in the two receptors are not equivalent and underscores the complexity of PTX modulation of LGICs. ( view less ) View Full Abstract View Article Details View Coded Data Related Articles Neuronal differentiation of P19 embryonal carcinoma cells modulates kinin B2 receptor gene expression and function. May 20, 2005 Antonio Henrique B Martins,Rodrigo R Resende,Paromita Majumder,Marcella Faria,Dulce E Casarini,Attila Tárnok,Walter Colli,João Bosco Pesquero,Henning Ulrich Kinins are vasoactive oligopeptides generated upon proteolytic cleavage of low and high molecular weight kininogens by kallikreins. These peptides have a well established signaling role in inflammation and homeostasis. Nevertheless, emerging evidence suggests that bradykinin and other kinins are st... ( view more )ored in the central nervous system and may act as neuromediators in the control of nociceptive response. Here we show that the kinin-B2 receptor (B2BKR) is differentially expressed during in vitro neuronal differentiation of P19 cells. Following induction by retinoic acid, cells form embryonic bodies and then undergo neuronal differentiation, which is complete after 8 and 9 days. Immunochemical staining revealed that B2BKR protein expression was below detection limits in nondifferentiated P19 cells but increased during the course of neuronal differentiation and peaked on days 8 and 9. Measurement of [Ca(2+)](i) in the absence and presence of bradykinin showed that most undifferentiated cells are unresponsive to bradykinin application, but following differentiation, P19 cells express high molecular weight neurofilaments, secrete bradykinin into the culture medium, and respond to bradykinin application with a transient increase in [Ca(2+)](i). However, inhibition of B2BKR activity with HOE-140 during early differentiation led to a decrease in the size of embryonic bodies formed. Pretreatment of differentiating P19 cells with HOE-140 on day 5 resulted in a reduction of the calcium response induced by the cholinergic agonist carbamoylcholine and decreased expression levels of M1-M3 muscarinic acetylcholine receptors, indicating crucial functions of the B2BKR during neuronal differentiation. ( view less ) View Full Abstract View Article Details View Coded Data Related Articles Role of cis-acting elements in the control of SERCA2b Ca2+ pump mRNA decay by nuclear proteins. May 15, 2005 Christine M Misquitta,Paromita Ghosh,James Mwanjewe,Ashok K Grover Alternative splicing at position 3495 b yields SERCA2 (sarco/endoplasmic reticulum Ca2+ pump 2) RNA species, namely SERCA2a and SERCA2b which differ in 3'-end regions. This results in SERCA2b RNA being less stable. In vitro decay experiments show that, in the presence of protein extracts from nucle... ( view more )i of LVMs (left ventricular myocytes), the rate of decay of both SERCA2b RNA and synthetic RNA from its 3'-region is greater than that of the corresponding SERCA2a RNA. To search for cis-acting instability elements in the 3'-region of SERCA2b, we examined the effects of LVM nuclear protein extracts on the in vitro decay of six short overlapping capped [m7G(5')ppp(5')Gm] and polyadenylated (A40) RNA fragments from the 3'-end region (3444-4472) of SERCA2b. The proximal fragment 2B1 (3444-3753) was the most unstable. 2B1 RNA without a cap or a polyadenylated tail was analysed further in electrophoretic mobility-shift assays, and was observed to bind to protein(s) in the nuclear extracts. Based on competition for binding to nuclear proteins between radiolabelled 2B1 RNA and short unlabelled RNA fragments, the cis-acting element involved in this binding was the sequence 2B1-4. 2B1-4 is a 35-base (3521-3555, CCAGUCCUGCUCGUUGUGGGCGUGCACCGAGGGGG) GC-rich region just past the splice site (3495). Nuclear extracts decreased the electrophoretic mobility of the radiolabelled 2B1-4 RNA which bound to two proteins (19 and 21 kDa) in cross-linking experiments. Excess 2B1-4 RNA decreased the decay of the 2B1 RNA by the nuclear protein extract. 2B1-del 4 RNA (2B1 with the 2B1-4 domain deleted) also decayed more slowly than the control 2B1 RNA. Thus SERCA2b contains a novel GC-rich cis-acting element involved in its decay by nuclear proteins. ( view less ) View Full Abstract View Article Details View Coded Data Related Articles Sequential DNA methylation of the Nanog and Oct-4 upstream regions in human NT2 cells during neuronal differentiation. Feb 25, 2005 Paromita Deb-Rinker,Dao Ly,Anna Jezierski,Marianna Sikorska,P Roy Walker Human NT2 cells, which differentiate into neurons and astrocytes, initially express and then permanently down-regulate Nanog and Oct-4 (POU5F1). We investigated the relationship between the expression of these genes and the methylation state of their 5'-flanking regions. Gene expression and DNA met... ( view more )hylation were assayed with quantitative polymerase chain reaction and bisulfite genomic sequencing, respectively. Retinoic acid-induced differentiation of NT2 cells to neurons is accompanied by a sequential decrease in the expression of both genes, paralleled by sequential epigenetic modification of their upstream regions. This is the first report demonstrating changes in DNA methylation in the promoter regions of Nanog and Oct-4 in a human cell line. ( view less ) View Full Abstract View Article Details View Coded Data Related Articles Binding of amino acids into a novel multiresponsive ferrocene receptor having an ene backbone. Feb 3, 2005 Paromita Debroy,Moloy Banerjee,Madhumita Prasad,Satya P Moulik,Sujit Roy [reaction: see text] Receptor 1 featuring two open arms, multipoint binding sites, and unsaturated linkers on a ferrocene platform shows strong 1:1 binding to unprotected alpha-amino acids (UV-vis, fluorescence, CV, ITC, NMR, and ESI-MS). NMR and ESI-MS studies suggest an encapsulative binding mode... ( view more ) involving the alpha,beta-unsaturated carbonyl residue (site for -NH3+, interaction A) and the terminal -OH groups (site for -COO-, interaction B). ( view less ) View Full Abstract View Article Details View Coded Data Related Articles Chlorpyrifos accumulation patterns for child-accessible surfaces and objects and urinary metabolite excretion by children for 2 weeks after crack-and-crevice application. Feb 2005 Paromita Hore,Mark Robson,Natalie Freeman,Jim Zhang,Daniel Wartenberg,Halûk Ozkaynak,Nicolle Tulve,Linda Sheldon,Larry Needham,Dana Barr,Paul J Lioy The Children's Post-Pesticide Application Exposure Study (CPPAES) was conducted to look at the distribution of chlorpyrifos within a home environment for 2 weeks after a routine professional crack-and-crevice application and to determine the amount of the chlorpyrifos that is absorbed by a child li... ( view more )ving within the home. Ten residential homes with a 2- to 5-year-old child in each were selected for study, and the homes were treated with chlorpyrifos. Pesticide measurements were made from the indoor air, indoor surfaces, and plush toys. In addition, periodic morning urine samples were collected from each of the children throughout the 2-week period. We analyzed the urine samples for 3,5,6-trichloropyridinol, the primary urinary metabolite of chlorpyrifos, and used the results to estimate the children's absorbed dose. Average chlorpyrifos levels in the indoor air and surfaces were 26 (pretreatment)/120 (posttreatment) ng/m3 and 0.48 (pretreatment)/2.8 (posttreatment) ng/cm2, respectively, reaching peak levels between days 0 and 2; subsequently, concentrations decreased throughout the 2-week period. Chlorpyrifos in/on the plush toys ranged from 7.3 to 1,949 ng/toy postapplication, with concentrations increasing throughout the 2-week period, demonstrating a cumulative adsorption/absorption process indoors. The daily amount of chlorpyrifos estimated to be absorbed by the CPPAES children postapplication ranged from 0.04 to 4.8 microg/kg/day. During the 2 weeks after the crack-and-crevice application, there was no significant increase in the amount of chlorpyrifos absorbed by the CPPAES children. ( view less ) View Full Abstract View Article Details View Coded Data Related Articles Contributions of children's activities to pesticide hand loadings following residential pesticide application. Jan 2005 Natalie C G Freeman,Paromita Hore,Kathleen Black,Marta Jimenez,Linda Sheldon,Nicolle Tulve,Paul J Lioy The role of children's activities in leading to pesticide exposure was evaluated by comparing pesticide loadings on the hands of children with the activities of the same children observed over a 4-h period. In all, 10 children ranging in age from 24 to 55 months were videotaped on the second day fo... ( view more )llowing a routine professional crack and crevice chlorpyrifos application in their homes. Before and following the video session, the children's hands were rinsed in isopropyl alcohol. Thus, only the chlorpyrifos that accumulated on and remained on the child's hands during the videotaping were removed for analysis after the videotaping session. The rinsate was analyzed for chlorpyrifos. The children's behaviors were quantified using virtual tracking device and the frequency and duration of behaviors, the hourly rate of behaviors, and the locations in which behaviors occurred were compared to hand loadings of pesticides. Pesticide hand loadings obtained following the videotaping sessions were associated with pesticide levels on surfaces and toys, but not with air levels. Pesticide loadings obtained following the videotaping sessions were also associated with frequencies, durations, and hourly rates of contact with bottles, and object-to-mouth behaviors, as well as contact duration with upholstered/textured surfaces. The hand loadings were also associated with the number of locations where the children exhibited object-to-mouth behavior and with children's use of house space during the videotaping sessions. ( view less ) View Full Abstract View Article Details View Coded Data Related Articles Control of SERCA2a Ca2+ pump mRNA stability by nuclear proteins: role of domains in the 3'-untranslated region. Jan 2005 Christine M Misquitta,Paromita Ghosh,James Mwanjewe,Ashok K Grover Alternative splicing of the sarco/endoplasmic reticulum (SERCA2) Ca2+ pump transcript generates the two isoforms: SERCA2a in left ventricular myocytes (LVM) and SERCA2b in most tissues. Nuclear protein extracts from left ventricular myocytes can cause a decay of the 3'-region of the SERCA2a. To det... ( view more )ermine if all the domains in the 800 b SERCA2a 3'-end region (3344-4243) are equally stable, we examined in vitro decay of synthetically capped, polyadenylated overlapping RNA fragments 2A1-2A6 from the 3'-end region of SERCA2a. Whereas 2A1-2A5 RNAs were stable, the distal fragment 2A6 (4135-4243 b) decayed rapidly. Deleting the 2A6 sequence from the 800-b 3'-end region increased its stability. In mobility shift assays, 2A6 bound to protein(s) in the LVM nuclear extracts in a specific manner: unlabelled 2A6 or the 800 b 3'-region RNA competed for binding but poly A, poly U, and poly C RNA did not. Secondary structure analysis revealed three hairpin loops in 2A6. Experiments using small synthetic RNA fragments for competition with 2A6 binding to nuclear proteins were consistent with a model involving the three hairpin loops. Thus, the secondary structure of the distal domain of SERCA2a RNA may be important in regulating its stability. ( view less ) View Full Abstract View Article Details View Coded Data Related Articles Immunobiochemical analysis of cross-reactive glutathione-S-transferase allergen from different fungal sources. 2005 Jay Shankar,Paromita D Gupta,Susheela Sridhara,B P Singh,S N Gaur,Naveen Arora Clinical observations suggest the presence of cross-reactive allergens. There is a need to identify these cross-reactive allergens to improve the treatment used for allergic disorders. The present study was aimed to identify and characterize a cross-reactive allergenic protein from fungi. Allergen ... ( view more )extracts of various fungi viz. Alternaria alternata, Aspergillus fumigatus, Cladosporium herbarum, Curvularia lunata, and Epicoccum purpurascens showed GST enzymatic activity ranging from 0.765 to 1.004 delta340 nm/min/microg where as activity of rGST was 1.123 delta340 nm/min/microg. Immunoblot with GST antibodies showed a band of approximately 26 kDa in all these fungal extracts. Sera of fungal allergy patients showed the presence of IgE antibodies to GST. Rabbit antibodies raised against the fungal extracts reacted with rGST confirming the presence of GST-like protein in these extract. ELISA inhibition using GST antibodies revealed inhibition with C. herbarum, A. alternata, C. lunata, A. fumigatus, and E. purpurascens demonstrating that fungal GST competes for binding to anti-GST. In summary, a GST-like protein was recognized as cross-reactive allergen in these fungal extracts. ( view less ) View Full Abstract View Article Details View Coded Data Related Articles The 5-HT3B subunit confers reduced sensitivity to picrotoxin when co-expressed with the 5-HT3A receptor. Nov 26, 2003 Paromita Das,Glenn H Dillon There are currently no known agents that display selectivity between homomeric 5-hydroxytryptamine type 3A (5-HT3A) and heteromeric 5-HT3A/3B receptors. In the present study, we show that the CNS convulsant picrotoxin selectively interacts with 5-HT3A receptors. In whole-cell patch clamp recordings... ( view more ), the inhibitory effect of PTX was reduced 100-fold in heteromeric mouse 5-HT3A/3B receptors, compared to homomeric 5-HT3A receptors. Picrotoxin should prove to be a useful probe for determining the presence of homomeric vs. heteromeric 5-HT3 receptors in both native tissue and recombinant receptor preparations. ( view less ) View Full Abstract View Article Details View Coded Data Related Articles Page 1 of 2 1 2 > (32 articles found)

      
 ESRNexus is provided as a service by TrialStat Corporation. ESRNexus is a registered trademark of TrialStat Corporation. Copyright 2008. View a list of all articles here